Quick Order    Shopping Cart    Online Seminar    Contact    My Account

Register for Special Offers

 

Learn more

Home  >  Products  >  miRNA Home  >  miRNA PCR Array  >   Inflammation

Inflammation miRNA PCR Array

Human Mouse
 
Human Inflammation miRNA PCR Array: MAH-105A
The Inflammation RT² miRNA PCR Array profiles the expression of 88 miRNA sequences predicted to regulate the expression of pro-inflammatory or anti-inflammatory genes. Only short, but not comprehensive, lists of microRNA sequences playing a role in specific biological processes, including inflammation, have been published to date. Bioinformatic-based prediction algorithms and databases are becoming increasingly sophisticated and accurate at identifying miRNA regulating the expression of genes involved in these model systems. Through the combination of genes relevant to this pathway and these predictive algorithms used to generate its miRNA list, this array provides researchers with a convenient way to quickly analyze, discover, or confirm which miRNA are most likely to be relevant to inflammation. The profiling results from this array can serve as a useful molecular marker for inflammation and provide a deeper understanding of the molecular mechanisms regulating gene expression during inflammation, especially by microRNA. Using real-time PCR, you can easily and reliably analyze the differential expression of a focused panel of miRNA sequences predicted to regulate inflammatory response genes with this array.

Both 96-well and 384-well ( 4 X 96 ) formats are available.
See the complete miRNA PCR Array list

Gene Table
 

How It Works Manual & Resources Reagents & Software
 

"If you have access to a real-time PCR instrument, you can use miRNA PCR Arrays"

The RT² miRNA PCR Arrays are the state-of-the-art solution for detecting and analyzing micro RNA using any real-time PCR instrument - whether you need to see the entire human miRNA genome or specific panels of miRNA sequences focused on your research. Genome-wide miRNA PCR Arrays discover novel functional roles for miRNA sequences. Disease- or pathway-focused miRNA PCR Arrays screen panels of miRNA sequences known to be associated with cancer or development in new model systems. The miRNA PCR Arrays can be used for research on cancer, immunology, stem cells, or biomarker discovery and validation as well as phenotypic analysis of cells or transgenic animals. See the complete list of miRNA PCR Arrays.

How it Works Performance Data Application Data

How it Works

The miRNA PCR array is a set of optimized real-time PCR assays, in 96-well or 384-well plates, for a miRNA panel as well as appropriate housekeeping assays and RNA quality controls. The PCR Array performs miRNA expression analysis with real-time RT-PCR sensitivity and the multi-sequence profiling capabilities of a microarray. Simply mix your cDNA template with the appropriate ready-to-use PCR master mix, aliquot equal volumes to each well of the same plate, and then run the real-time PCR cycling program. (Download user manual)

Figure 1: How PCR Arrays Work - Protocol Chart

What it offers?
     Guaranteed Performance* - ready-to-use for gene expression analysis
     Time and cost saving - less than 30 min hands-on time to analyze 88 or 376 miRNA
     Ease of data analysis - easy-to-use Excel-Based Data Analysis Template

Layout and Controls: The miRNA PCR Arrays are available in both 96- and 384-well plates and are used to monitor the expression of 88 or 376 miRNA, respectively, plus four housekeeping assays for small nuclear RNA to normalize raw data. Controls are also included on each array for RNA quality and general PCR performance.

You can easily perform a PCR Array experiment in your own laboratory, or send your samples to us and take advantage of our PCR Array Gene Expression Analysis Services.

*: when using complete miRNA PCR array system.

Performance Data:

Real-time RT-PCR is the most sensitive and reliable method for analyzing the expression of nucleic acids like miRNA. Its wide dynamic range makes it the preferred choice for simultaneously quantifying both rare and abundant sequences in the same sample. However, the small size and high degree of similarity among miRNA sequences makes quantitative analyses of their abundance very challenging. Any assay for miRNA must not only demonstrate the sensitivity and reproducibility expected of real-time PCR, but also be specific enough to discriminate between sequences that differ by as little as one mismatch to achieve that high level of performance.

The patent-pending technologies in the miRNA PCR Array System dramatically improve specificity for closely related mature miRNA over their precursors. The uniformly high PCR amplification efficiencies of the built-in assays simultaneously detect any miRNA sequence in the human genome with high sensitivity and specificity. The experimental results below will show that the RT² miRNA PCR Array and Assay System meets these performance criteria.

Improved Discrimination & Specificity:
The proprietary primer design of the RT² miRNA PCR Array and Assays distinguishes miRNA family members with single nucleotide mismatches providing greater discrimination and specificity than other commercial providers.

Synthetic
miRNA Template
Assay Primers Relative Detection
(%Perfect Match)
 miRNA Template Sequence
miR-10a miR-10a 100.00 UACCCUGUAGAUCCGAAUUUGUG
miR-10b 0.98
miR-10b miR-10b 100.00 UACCCUGUAGAACCGAAUUUGUG
miR-10a 0.01
miR-99a mir-99a 100.00 AACCCGUAGAUCCGAUCUUGUG
miR-100 0.54
miR-100 miR-100 100.00 AACCCGUAGAUCCGAACUUGUG
mir-99a 0.07
miR-196a miR-196a 100.00 UAGGUAGUUUCAUGUUGUUGGG
miR-196b 0.20
miR-196b miR-196b 100.00 UAGGUAGUUUCCUGUUGUUGGG
miR-196a 1.64
Relative detection as a percent of the perfect match (100 x 2- ΔΔCt) is calculated from the Ct values of target and off-target assays used to detect 105 copies of synthetic miRNA template. The observed cross-reactivity seen between RT² miRNA qPCR Assays for different miRNA species are compared.

Specific Detection Improves Sensitivity & Dynamic Range
The patent-pending chemistry of the RT² miRNA First Strand Kit preferentially reverse transcribes mature miRNA, thereby decreasing non-specific background and increasing sensitivity.

Figure 2: Synthetic mir-658 was serially diluted into a constant amount (100 ng) of small RNA enriched from 293H cells lacking that sequence. Samples were analyzed with mir-658-specific RT² miRNA qPCR Assays and other commercial assays. The resulting threshold cycles of the assays are plotted versus the log10 of the number of mir-658 template copies. The RT² miRNA PCR Assays provide three orders of magnitude greater sensitivity than competing assays, which amplify non-specific products more evident at lower amounts of input material.

High Reproducibility
Reliably compare results across cycling runs, arrays, plates, and samples.

Figure 3: Duplicate samples of small RNA enriched from human brain tissue (Ambion, 200 ng) were characterized using the RT² Human Genome miRNA PCR array on an ABI 7900HT. Raw Ct values greater than 35 or reported as "not determined" were first changed to 35. The values from the replicate arrays were plotted against each other, and then the data was fit to a straight line. The miRNA PCR Arrays demonstrate high degrees of technical reproducibility with strong correlation factors (R2 > 0.99).

Application Data

The regulated expression of miRNA adds another layer to an already complex gene regulatory network. One miRNA can regulate multiple mRNA targets, and one target mRNA may be regulated by multiple miRNA sequences. Therefore, the role that any given miRNA sequence plays has yet to be completely defined. Correlating miRNA expression profiles to biological phenotypes adds to our understanding of miRNA-based gene regulation.

Analyzing a representative set of sequences with the Genome or miFinder arrays discovers novel functional roles for each miRNA. Focused miRNA panels, like those on the Cancer or the Cell Differentiation and Development arrays, screen miRNA biomarkers known to be most important to their specific model system. The representative results below will illustrate experiments that may be performed with the RT² miRNA PCR Array and Assay System.

Cancer Research: Identifying miRNA Cancer Biomarkers
The RT² Human Cancer miRNA PCR Array identifies potential colon cancer biomarkers. Many of the miRNA sequences are up-regulated in colon cancer.

Figure 4: Small RNA isolated from human colon tumor and matched adjacent normal tissue (Biochain) was characterized with PCR Arrays containing assays specific for 88 cancer-related human miRNA sequences. The fold-differences plotted for each miRNA are calculated from via the ΔΔCt method and raw data normalized to a panel of housekeeping small nuclear RNA.

Development Research: Identifying Tissue-Specific miRNA Biomarkers
The RT² Human Cell Differentiaion & Development miRNA PCR Array identifies 26 brain- and 20 muscle-specific miRNA.

Figure 5: Small RNA enriched from human brain and muscle tissue total RNA (200 ng, Ambion) were characterized with PCR Arrays containing assays for 88 differentiation-related miRNA sequences. Normalized miRNA sequence expression levels for both tissues are calculated and plotted against each other. Symbols outside the red lines represent miRNA with at least a 2-fold expression difference in the respective tissues.

Signal Transduction Research: Screen the Genome for p53-Responsive miRNA
RT² Human Genome miRNA PCR Array identifies known and novel miRNA sequences responsive to p53 over-expression. The array identifies the well-known p53 targets, mir-34a and mir-34c, as well as a dozen new candidate targets including mir-203, mir-551a, mir-940, mir-614, and others.

Figure 6: PC3 cells were transduced with adenovirus either encoding p53 or containing an empty vector. After 48 h, small RNA was characterized with PCR Arrays containing 376 human miRNA-specific assays. The heat map visualizes the fold-differences in miRNA expression upon p53 over-expression (red, up-regulated miRNA; green, down-regulated miRNA; black, no difference).

Back to Top

 

How It Works Manual & Resources Reagents & Software
 
User Manual RT² miRNA PCR Array User Manual (PDF)
White Paper PCR Array: A Simple and Quantitative Method for Gene Expression Profiling (PDF)
Data Analysis Free PCR Array Data Analysis Software (Web & Excel based)
Instrument Setup Instructions Materials & Equipment Required for our PCR products

PCR Array Instrument Setup Instructions & Protocol Files

Web Seminars Attend a live on-line seminar hosted by an Applications Scientist about PCR
Technical Brochures miRNA Flyer (PDF)

SYBR Green Master Mix Brochure (PDF)

Pathway Central Pathway reviews and presentation-ready pathway maps
Back to Top
 

How It Works Manual & Resources Reagents & Software
 

The complete RT² miRNA PCR Array System insures that you will get good results from your pathway-focused gene expression analysis experiment the first time, and every time guaranteed.

The Complete RT² miRNA PCR Array System Includes:

Our convenient and high-quality real-time RT-PCR accessory products complete the RT² miRNA PCR Array System and the RT² miRNA qPCR Assays. The other components needed for real-time PCR analysis are SYBR Green PCR master mix, first strand synthesis kit, and small RNA isolation kit.

Back to Top